CLECSF6 (CLEC4A) (NM_194447) Human Untagged Clone
CAT#: SC317293
CLEC4A (untagged)-Human C-type lectin domain family 4, member A (CLEC4A), transcript variant 3
CNY 3,600.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | CD367; CLECSF6; DCIR; DDB27; HDCGC13P; hDCIR; LLIR |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>NCBI ORF sequence for NM_194447, the custom clone sequence may differ by one or more nucleotides
ATGACTTCGGAAATCACTTATGCTGAAGTGAGGTTCAAAAATGAATTCAAGTCCTCAGGCATCAACACAG CCTCTTCTGCAGTTTTCTTTCAAAAATATTCTCAGCTTCTTGAAAAAAAGACTACAAAAGAGCTGGTTCA TACAACATTGGAGTGTGTGAAAAAAAATATGCCCGTGGAAGAGACAGCCTGGAGCTGTTGCCCAAAGAAT TGGAAGTCATTTAGTTCCAACTGCTACTTTATTTCTACTGAATCAGCATCTTGGCAAGACAGTGAGAAGG ACTGTGCTAGAATGGAGGCTCACCTGCTGGTGATAAACACTCAAGAAGAGCAGGATTTCATCTTCCAGAA TCTGCAAGAAGAATCTGCTTATTTTGTGGGGCTCTCAGATCCAGAAGGTCAGCGACATTGGCAATGGGTT GATCAGACACCATACAATGAAAGTTCCACATTCTGGCATCCACGTGAGCCCAGTGATCCCAATGAGCGCT GCGTTGTGCTAAATTTTCGTAAATCACCCAAAAGATGGGGCTGGAATGATGTTAATTGTCTTGGTCCTCA AAGGTCAGTTTGTGAGATGATGAAGATCCACTTATGA |
Restriction Sites | Please inquire |
ACCN | NM_194447 |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_194447.2, NP_919429.2 |
RefSeq Size | 1167 bp |
RefSeq ORF | 597 bp |
Locus ID | 50856 |
UniProt ID | Q9UMR7 |
Protein Families | Druggable Genome, Transmembrane |
Gene Summary | This gene encodes a member of the C-type lectin/C-type lectin-like domain (CTL/CTLD) superfamily. Members of this family share a common protein fold and have diverse functions, such as cell adhesion, cell-cell signalling, glycoprotein turnover, and roles in inflammation and immune response. The encoded type 2 transmembrane protein may play a role in inflammatory and immune response. Multiple transcript variants encoding distinct isoforms have been identified for this gene. This gene is closely linked to other CTL/CTLD superfamily members on chromosome 12p13 in the natural killer gene complex region. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (3), also known as LLIRv1, lacks an in-frame segment of the coding region, compared to variant 1. It encodes a shorter isoform (3), that is missing the transmembrane domain compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC214789 | CLEC4A (Myc-DDK-tagged)-Human C-type lectin domain family 4, member A (CLEC4A), transcript variant 3 |
CNY 3,990.00 |
|
RC214789L3 | Lenti-ORF clone of CLEC4A (Myc-DDK-tagged)-Human C-type lectin domain family 4, member A (CLEC4A), transcript variant 3 |
CNY 5,890.00 |
|
RC214789L4 | Lenti-ORF clone of CLEC4A (mGFP-tagged)-Human C-type lectin domain family 4, member A (CLEC4A), transcript variant 3 |
CNY 5,890.00 |
|
RG214789 | CLEC4A (tGFP-tagged) - Human C-type lectin domain family 4, member A (CLEC4A), transcript variant 3 |
CNY 4,370.00 |
其它CLECSF6产品