PPP2R4 (PTPA) (NM_001271832) Human Untagged Clone
CAT#: SC330980
PPP2R4 (untagged) - Homo sapiens protein phosphatase 2A activator, regulatory subunit 4 (PPP2R4), transcript variant 7
CNY 2,950.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | PP2A; PPP2R4; PR53 |
Vector | pCMV6-Entry |
Sequence Data |
>SC330980 representing NM_001271832.
Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGGCTGAGGGCGAGCGGCAGCCGCCGCCAGATTCTTCAGAGGAGGCCCCTCCAGCCACTCAGAACTTC ATCATTCCAAAAAAGGAGATCCACACAGTTCCAGACATGGGCAAATGGAAGCGTTCTCAGGCCATTGAG AAACTAGTCGCTCTTCTCAACACGCTGGACAGGTGGATTGATGAGACTCCTCCAGTGGACCAGCCCTCT CGGTTTGGGAATAAGGCATACAGGACCTGGTATGCCAAACTTGATGAGGAAGCAGAAAACTTGGTGGCC ACAGTGGTCCCTACCCATCTGGCAGCTGCTGTGCCTGAGGTGGCTGTTTACCTAAAGGAGTCAGTGGGG AACTCCACGCGCATTGACTACGGCACAGGGCATGAGGCAGCCTTCGCTGCTTTCCTCTGCTGTCTCTGC AAGATTGGGGTGCTCCGGGTGGATGACCAAATAGCTATTGTCTTCAAGGTGTTCAATCGGTACCTTGAG GTTATGCGGAAACTCCAGAAAACATACAGGATGGAGCCAGCCGGCAGCCAGGGAGTGTGGGGTCTGGAT GACTTCCAGTTTCTGCCCTTCATCTGGGGCAGTTCGCAGCTGATAGACCACCCATACCTGGAGCCCAGA CACTTTGTGGATGAGAAGGCCGTGAATGAGAACCACAAGGACTACATGTTCCTGGAGTGTATCCTGTTT ATTACCGAGATGAAGACTGGCCCATTTGCAGAGCACTCCAACCAGCTGTGGAACATCAGCGCCGTCCCT TCCTGGTCCAAAGTGAACCAGGGTCTCATCCGCATGTATAAGGCCGAGTGCCTGGAGAAGTTCCCTGTG ATCCAGCACTTCAAGTTCGGGAGCCTGCTGCCCATCCATCCTGTCACGTCGGGCTAG |
Restriction Sites | SgfI-MluI |
ACCN | NM_001271832 |
Insert Size | 885 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001271832.1 |
RefSeq Size | 2677 bp |
RefSeq ORF | 885 bp |
Locus ID | 5524 |
UniProt ID | Q15257 |
Protein Families | Druggable Genome, Phosphatase |
MW | 33.5 kDa |
Gene Summary | Protein phosphatase 2A is one of the four major Ser/Thr phosphatases and is implicated in the negative control of cell growth and division. Protein phosphatase 2A holoenzymes are heterotrimeric proteins composed of a structural subunit A, a catalytic subunit C, and a regulatory subunit B. The regulatory subunit is encoded by a diverse set of genes that have been grouped into the B/PR55, B'/PR61, and B''/PR72 families. These different regulatory subunits confer distinct enzymatic specificities and intracellular localizations to the holozenzyme. The product of this gene belongs to the B' family. This gene encodes a specific phosphotyrosyl phosphatase activator of the dimeric form of protein phosphatase 2A. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (7) lacks two consecutive exons in the coding region, compared to variant 1. The resulting isoform (f) lacks an internal segment, compared to isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC232395 | PPP2R4 (Myc-DDK tagged) - Homo sapiens protein phosphatase 2A activator, regulatory subunit 4 (PPP2R4), transcript variant 7 |
CNY 3,990.00 |
|
RG232395 | PPP2R4 (tGFP-tagged) - Homo sapiens protein phosphatase 2A activator, regulatory subunit 4 (PPP2R4), transcript variant 7 |
CNY 4,370.00 |