PPP2R4 (PTPA) (NM_001271832) Human Untagged Clone

CAT#: SC330980

PPP2R4 (untagged) - Homo sapiens protein phosphatase 2A activator, regulatory subunit 4 (PPP2R4), transcript variant 7



  "NM_001271832" in other vectors (2)

CNY 2,950.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


PTPA rabbit polyclonal antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms PP2A; PPP2R4; PR53
Vector pCMV6-Entry
Sequence Data
>SC330980 representing NM_001271832.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGCTGAGGGCGAGCGGCAGCCGCCGCCAGATTCTTCAGAGGAGGCCCCTCCAGCCACTCAGAACTTC
ATCATTCCAAAAAAGGAGATCCACACAGTTCCAGACATGGGCAAATGGAAGCGTTCTCAGGCCATTGAG
AAACTAGTCGCTCTTCTCAACACGCTGGACAGGTGGATTGATGAGACTCCTCCAGTGGACCAGCCCTCT
CGGTTTGGGAATAAGGCATACAGGACCTGGTATGCCAAACTTGATGAGGAAGCAGAAAACTTGGTGGCC
ACAGTGGTCCCTACCCATCTGGCAGCTGCTGTGCCTGAGGTGGCTGTTTACCTAAAGGAGTCAGTGGGG
AACTCCACGCGCATTGACTACGGCACAGGGCATGAGGCAGCCTTCGCTGCTTTCCTCTGCTGTCTCTGC
AAGATTGGGGTGCTCCGGGTGGATGACCAAATAGCTATTGTCTTCAAGGTGTTCAATCGGTACCTTGAG
GTTATGCGGAAACTCCAGAAAACATACAGGATGGAGCCAGCCGGCAGCCAGGGAGTGTGGGGTCTGGAT
GACTTCCAGTTTCTGCCCTTCATCTGGGGCAGTTCGCAGCTGATAGACCACCCATACCTGGAGCCCAGA
CACTTTGTGGATGAGAAGGCCGTGAATGAGAACCACAAGGACTACATGTTCCTGGAGTGTATCCTGTTT
ATTACCGAGATGAAGACTGGCCCATTTGCAGAGCACTCCAACCAGCTGTGGAACATCAGCGCCGTCCCT
TCCTGGTCCAAAGTGAACCAGGGTCTCATCCGCATGTATAAGGCCGAGTGCCTGGAGAAGTTCCCTGTG
ATCCAGCACTTCAAGTTCGGGAGCCTGCTGCCCATCCATCCTGTCACGTCGGGCTAG

Restriction Sites SgfI-MluI     
ACCN NM_001271832
Insert Size 885 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001271832.1
RefSeq Size 2677 bp
RefSeq ORF 885 bp
Locus ID 5524
UniProt ID Q15257
Protein Families Druggable Genome, Phosphatase
MW 33.5 kDa
Gene Summary Protein phosphatase 2A is one of the four major Ser/Thr phosphatases and is implicated in the negative control of cell growth and division. Protein phosphatase 2A holoenzymes are heterotrimeric proteins composed of a structural subunit A, a catalytic subunit C, and a regulatory subunit B. The regulatory subunit is encoded by a diverse set of genes that have been grouped into the B/PR55, B'/PR61, and B''/PR72 families. These different regulatory subunits confer distinct enzymatic specificities and intracellular localizations to the holozenzyme. The product of this gene belongs to the B' family. This gene encodes a specific phosphotyrosyl phosphatase activator of the dimeric form of protein phosphatase 2A. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (7) lacks two consecutive exons in the coding region, compared to variant 1. The resulting isoform (f) lacks an internal segment, compared to isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...