BID (NM_001244569) Human Untagged Clone

CAT#: SC332074

BID (untagged) - Homo sapiens BH3 interacting domain death agonist (BID), transcript variant 5



  "NM_001244569" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


BID mouse monoclonal antibody,clone OTI1G10
    • 100 ul

CNY 1,999.00
CNY 2,700.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms FP497
Vector pCMV6-Entry
Sequence Data
>SC332074 representing NM_001244569.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGACCGTAGCATCCCTCCGGGCCTGGTGAACGGCCTGGCCCTGCAGCTCAGGAACACCAGCCGGTCG
GAGGAGGACCGGAACAGGGACCTGGCCACTGCCCTGGAGCAGCTGCTGCAGGCCTACCCTAGAGACATG
GAGAAGGAGAAGACCATGCTGGTGCTGGCCCTGCTGCTGGCCAAGAAGGTGGCCAGTCACACGCCGTCC
TTGCTCCGTGATGTCTTTCACACAACAGTGAATTTTATTAACCAGAACCTACGCACCTACGTGAGGAGC
TTAGCCAGAAATGGGATGGACTGA

Restriction Sites SgfI-MluI     
ACCN NM_001244569
Insert Size 300 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001244569.1
RefSeq Size 2006 bp
RefSeq ORF 300 bp
Locus ID 637
UniProt ID P55957
Protein Families Druggable Genome
Protein Pathways Alzheimer's disease, Amyotrophic lateral sclerosis (ALS), Apoptosis, Natural killer cell mediated cytotoxicity, p53 signaling pathway, Pathways in cancer, Viral myocarditis
MW 11.3 kDa
Gene Summary This gene encodes a death agonist that heterodimerizes with either agonist BAX or antagonist BCL2, and thus regulate apoptosis. The encoded protein is a member of the BCL-2 family of cell death regulators. It is a mediator of mitochondrial damage induced by caspase-8 (CASP8); CASP8 cleaves this encoded protein, and the COOH-terminal part translocates to mitochondria where it triggers cytochrome c release. Multiple alternatively spliced transcript variants have been found. [provided by RefSeq, Aug 2020]
Transcript Variant: This variant (5) has an alternate 5' exon and uses a downstream in-frame start codon, as compared to variant 1. The encoded isoform 3 thus has a shorter N-terminus, as compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...