Bestrophin 3 (BEST3) (NM_001282616) Human Untagged Clone

Specifications

Product Data
Type	Human Untagged Clone
Tag	Tag Free
Synonyms	VMD2L3
Vector	pCMV6-Entry
E. coli Selection	Kanamycin (25 ug/mL)
Mammalian Cell Selection	Neomycin
Sequence Data	Fully Sequenced ORF (showhide) >SC333355 representing NM_001282616. Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGTTCCTCATCTCTAGCAGTGTTCACGGAAGCGACGAGCACGGGCGCCTGCTTAGAAGGACGCTGATG CGCTACGTCAATCTCACCTCCCTGCTCATCTTTCGCTCGGTGAGCACTGCTGTGTACAAAAGATTTCCC ACAATGGACCACGTGGTTGAAGCAGAAAGAACTGGCATGAAACCCATTCTGCCTTCAAGTTTTGAGATG CAGAGCTTTTAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
Restriction Sites	SgfI-MluI
ACCN	NM_001282616
Insert Size	219 bp
OTI Disclaimer	Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components	The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution	1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq	NM_001282616.1
RefSeq Size	1943 bp
RefSeq ORF	219 bp
Locus ID	144453
UniProt ID	Q8N1M1
Protein Families	Ion Channels: Other, Transmembrane
MW	8.3 kDa
Gene Summary	BEST3 belongs to the bestrophin family of anion channels, which includes BEST1 (MIM 607854), the gene mutant in vitelliform macular dystrophy (VMD; MIM 153700), and 2 other BEST1-like genes, BEST2 (MIM 607335) and BEST4 (MIM 607336). Bestrophins are transmembrane (TM) proteins that share a homology region containing a high content of aromatic residues, including an invariant arg-phe-pro (RFP) motif. The bestrophin genes share a conserved gene structure, with almost identical sizes of the 8 RFP-TM domain-encoding exons and highly conserved exon-intron boundaries. Each of the 4 bestrophin genes has a unique 3-prime end of variable length (Stohr et al., 2002 [PubMed 12032738]; Tsunenari et al., 2003 [PubMed 12907679]).[supplied by OMIM, Mar 2008] Transcript Variant: This variant (6) lacks a portion of the 5' UTR and 5' coding region, uses a downstream in-frame start codon, and lacks several 3' exons but includes an alternate 3' terminal exon, compared to variant 1. The encoded isoform (5) is shorter at the N-terminus, has a distinct C-terminus and is significantly shorter than isoform 1. Both variants 5 and 6 encode isoform 5. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.