NME4 (NM_001286438) Human Untagged Clone

CAT#: SC333628

NME4 (untagged) - Human NME/NM23 nucleoside diphosphate kinase 4 (NME4), transcript variant 5



  "NM_001286438" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
Anti-NME4 mouse monoclonal antibody, clone OTI1A5 (formerly 1A5)
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms NDPK-D; nm23-H4; NM23H4
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC333628 representing NM_001286438.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGAAGATGCTGCAGGCACCAGAGAGCGTCCTTGCCGAGCACTACCAGGACCTGCGGAGGAAGCCCTTC
TACCCTGCCCTCATCCGCTACATGAGCTCTGGGCCTGTGGTGGCCATGGTCTGGGAAGGGTACAATGTC
GTCCGCGCCTCGAGGGCCATGATTGGACACACCGACTCGGCTGAGGCTGCCCCAGGAACCATAAGGGGT
GACTTCAGCGTCCACATCAGCAGGAATGTCATCCACGCCAGCGACTCCGTGGAGGGGGCCCAGCGGGAG
ATCCAGCTGTGGTTCCAGAGCAGTGAGCTGGTGAGCTGGGCAGACGGGGGCCAGCACAGCAGCATCCAC
CCAGCCTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001286438
Insert Size 354 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001286438.1
RefSeq Size 1237 bp
RefSeq ORF 354 bp
Locus ID 4833
UniProt ID O00746
Protein Families Druggable Genome
Protein Pathways Metabolic pathways, Purine metabolism, Pyrimidine metabolism
MW 13 kDa
Gene Summary The nucleoside diphosphate (NDP) kinases (EC 2.7.4.6) are ubiquitous enzymes that catalyze transfer of gamma-phosphates, via a phosphohistidine intermediate, between nucleoside and dioxynucleoside tri- and diphosphates. The enzymes are products of the nm23 gene family, which includes NME4 (Milon et al., 1997 [PubMed 9099850]).[supplied by OMIM, May 2008]
Transcript Variant: This variant (5) contains an alternate exon and initiates translation at an alternate downstream start codon compared to variant 1. The resulting isoform (d) is shorter at the N-terminus compared to isoform a. Variants 4, 5, 6, and 7 all encode the same isoform (d).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...