STK25 (NM_001282307) Human Untagged Clone

CAT#: SC335396

STK25 (untagged) - Human serine/threonine kinase 25 (STK25), transcript variant 6



  "NM_001282307" in other vectors (2)

CNY 3,230.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal antibody to STK25 (serine/threonine kinase 25 (STE20 homolog, yeast))
    • 100 ul

CNY 6,281.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms SOK1; YSK1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC335396 representing NM_001282307.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGAGTACCTGGGCGGCGGCTCAGCACTGGACTTGCTTAAACCAGGTCCCCTGGAGGAGACATACATT
GCCACGATCCTGCGGGAGATTCTGAAGGGCCTGGATTATCTGCACTCCGAACGCAAGATCCACCGAGAC
ATCAAAGCTGCCAACGTGCTACTCTCGGAGCAGGGTGACGTGAAGCTGGCGGACTTTGGGGTAGCAGGG
CAGCTCACAGACACGCAGATTAAGAGGAACACATTCGTGGGCACCCCCTTCTGGATGGCACCTGAGGTC
ATCAAGCAGTCGGCCTACGACTTCAAGGCTGACATCTGGTCCCTGGGGATCACAGCCATCGAGCTGGCC
AAGGGGGAGCCTCCAAACTCTGACCTCCACCCCATGCGCGTCCTGTTCCTGATTCCCAAGAACAGCCCA
CCCACACTGGAGGGCCAGCACAGCAAGCCCTTCAAGGAGTTCGTGGAGGCCTGCCTCAACAAAGACCCC
CGATTCCGGCCCACGGCCAAGGAGCTCCTGAAGCACAAGTTCATCACACGCTACACCAAGAAGACCTCC
TTCCTCACGGAGCTCATCGACCGCTATAAGCGCTGGAAGTCAGAGGGGCATGGCGAGGAGTCCAGCTCT
GAGGACTCTGACATTGATGGCGAGGCGGAGGACGGGGAGCAGGGCCCCATCTGGACGTTCCCCCCTACC
ATCCGGCCGAGTCCACACAGCAAGCTTCACAAGGGGACGGCCCTGCACAGTTCACAGAAGCCTGCGGAG
CCCGTCAAGAGGCAGCCGAGGTCCCAGTGCCTGTCCACGCTGGTCCGGCCCGTCTTCGGAGAGCTCAAA
GAGAAGCACAAGCAGAGCGGCGGGAGCGTGGGTGCGCTGGAGGAGCTGGAGAACGCCTTCAGCCTGGCC
GAGGAGTCCTGCCCCGGCATCTCAGACAAGCTGATGGTGCACCTGGTGGAGCGAGTGCAGAGGTTTTCA
CACAACAGAAACCACCTGACATCCACCCGCTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001282307
Insert Size 999 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001282307.1
RefSeq Size 2459 bp
RefSeq ORF 999 bp
Locus ID 10494
UniProt ID O00506
Protein Families Druggable Genome, Protein Kinase
MW 37.3 kDa
Gene Summary This gene encodes a member of the germinal centre kinase III (GCK III) subfamily of the sterile 20 superfamily of kinases. The encoded enzyme plays a role in serine-threonine liver kinase B1 (LKB1) signaling pathway to regulate neuronal polarization and morphology of the Golgi apparatus. The protein is translocated from the Golgi apparatus to the nucleus in response to chemical anoxia and plays a role in regulation of cell death. A pseudogene associated with this gene is located on chromosome 18. Multiple alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, Dec 2012]
Transcript Variant: This variant (6) lacks an exon which contains a portion of the 5' UTR and 5' coding region including the start codon, compared to variant 1. These differences cause translation initiation at a downstream start codon and result in an isoform (3) with a shorter N-terminus, compared to isoform 1. Variants 2, 6, and 7 encode the same isoform (3).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...