Ddx3x (NM_010028) Mouse Untagged Clone

CAT#: MC220236

Ddx3x (untagged) - Mouse DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 3, X-linked (Ddx3x), (10ug)



  "NM_010028" in other vectors (4)

CNY 8,550.00


货期*
5周

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms D1Pas1-rs2; Ddx3; Fin14
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC220236 representing NM_010028
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGAGTCATGTGGCAGTGGAAAATGCGCTCGGGCTGGACCAGCAGTTTGCTGGCCTAGACCTGAACTCTT
CAGATAATCAGAGTGGAGGAAGTACAGCAAGCAAAGGGCGTTATATCCCACCTCATTTAAGGAACAGAGA
AGCTACTAAAGGATTCTATGACAAAGACAGTTCAGGGTGGAGTTCTAGTAAAGATAAGGATGCATACAGC
AGTTTTGGATCACGGGGTGATTCAAGAGGGAAGTCTAGCTTCTTTGGAGATCGTGGAAGTGGATCAAGGG
GAAGGTTTGATGATCGTGGACGGGGAGACTATGATGGCATTGGTGGCCGTGGAGATAGAAGTGGCTTTGG
CAAATTTGAAAGAGGTGGAAATAGTCGCTGGTGTGACAAATCAGATGAAGATGACTGGTCAAAGCCACTC
CCACCAAGTGAACGATTGGAACAGGAACTCTTTTCTGGAGGCAATACTGGGATTAACTTTGAGAAATATG
ATGACATTCCAGTCGAAGCAACAGGCAACAACTGTCCTCCACACATTGAAAGTTTCAGTGATGTCGAGAT
GGGAGAAATTATTATGGGAAACATTGAGCTTACTCGTTATACTCGCCCAACTCCAGTGCAGAAGCATGCT
ATTCCTATTATCAAAGAGAAAAGAGACTTGATGGCTTGTGCTCAAACAGGCTCTGGAAAAACTGCAGCAT
TTCTCTTGCCCATCTTGAGTCAGATCTATGCTGATGGTCCAGGAGAAGCTCTGAGGGCTATGAAGGAAAA
TGGAAGATATGGCCGTCGTAAACAGTATCCAATCTCTTTGGTACTGGCACCAACGAGAGAATTGGCAGTG
CAGATCTATGAGGAAGCCAGAAAATTCTCATACCGATCTAGAGTCCGTCCTTGCGTGGTTTATGGTGGTG
CTGAAATTGGCCAGCAGATTCGAGACTTAGAACGTGGATGCCACTTGTTAGTAGCCACTCCAGGACGTCT
AGTGGATATGATGGAGAGAGGGAAGATCGGGTTAGACTTCTGCAAATACCTGGTGTTAGATGAAGCTGAC
CGGATGTTAGATATGGGGTTTGAACCTCAGATACGAAGAATAGTTGAACAAGACACTATGCCTCCAAAAG
GTGTCCGCCACACTATGATGTTTAGTGCTACTTTTCCTAAGGAAATACAGATGCTGGCCCGTGATTTCTT
AGATGAGTACATATTTCTGGCTGTAGGAAGAGTTGGGTCTACTTCAGAGAACATCACACAAAAAGTGGTT
TGGGTGGAGGAGATAGACAAAAGGTCATTTCTGCTTGACCTTCTAAATGCAACAGGCAAGGATTCCCTGA
CTCTAGTGTTTGTGGAGACCAAAAAGGGGGCAGATTCGCTGGAGGATTTCTTATACCATGAAGGATATGC
TTGTACCAGTATCCATGGAGACCGTTCTCAGAGAGATAGGGAAGAGGCCCTTCACCAGTTCCGCTCAGGA
AAAAGCCCAATTCTAGTGGCTACAGCAGTAGCAGCAAGAGGACTGGATATTTCAAATGTGAAGCATGTTA
TTAATTTTGACCTGCCTAGTGATATCGAAGAATATGTGCATCGCATAGGCCGTACAGGCCGTGTGGGAAA
CCTTGGTCTTGCCACCTCATTCTTTAATGAAAGGAATATAAATATCACAAAGGATTTACTGGATCTTCTT
GTTGAAGCAAAACAAGAAGTGCCTTCTTGGTTAGAGAACATGGCTTTTGAACACCACTACAAGGGTAGCA
GTCGTGGACGTTCTAAGAGCAGTCGATTTAGTGGAGGGTTTGGTGCCAGAGACTACCGACAGAGTAGCGG
TGCCAGCAGTTCCAGCTTCAGCAGCAGCCGTGCAAGCAGCAGTCGAAGTGGTGGAGGTGGCCATGGCGGC
AGTCGAGGATTTGGTGGAGGTGGCTACGGAGGCTTTTACAACAGTGATGGATATGGAGGGAATTATAACT
CCCAGGGGGTTGACTGGTGGGGTAACTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_010028
Insert Size 1989 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_010028.3, NP_034158.1
RefSeq Size 4571 bp
RefSeq ORF 1989 bp
Locus ID 13205
UniProt ID Q62167
Gene Summary Multifunctional ATP-dependent RNA helicase. The ATPase activity can be stimulated by various ribo- and deoxynucleic acids indicative for a relaxed substrate specificity. In vitro can unwind partially double-stranded DNA with a preference for 5'-single-stranded DNA overhangs. Is involved in several steps of gene expression, such as transcription, mRNA maturation, mRNA export and translation. However, the exact mechanisms are not known and some functions may be specific for a subset of mRNAs. Involved in transcriptional regulation. Can enhance transcription from the CDKN1A/WAF1 promoter in a SP1-dependent manner. Found associated with the E-cadherin promoter and can down-regulate transcription from the promoter. Involved in regulation of translation initiation. Proposed to be involved in positive regulation of translation such as of cyclin E1/CCNE1 mRNA and specifically of mRNAs containing complex secondary structures in their 5'UTRs; these functions seem to require RNA helicase activity. Specifically promotes translation of a subset of viral and cellular mRNAs carrying a 5'proximal stem-loop structure in their 5'UTRs and cooperates with the eIF4F complex. Proposed to act prior to 43S ribosomal scanning and to locally destabilize these RNA structures to allow recognition of the mRNA cap or loading onto the 40S subunit. After association with 40S ribosomal subunits seems to be involved in the functional assembly of 80S ribosomes; the function seems to cover translation of mRNAs with structured and non-structured 5'UTRs and is independent of RNA helicase activity. Also proposed to inhibit cap-dependent translation by competetive interaction with EIF4E which can block the EIF4E:EIF4G complex formation. Proposed to be involved in stress response and stress granule assembly; the function is independent of RNA helicase activity and seems to involve association with EIF4E. May be involved in nuclear export of specific mRNAs but not in bulk mRNA export via interactions with XPO1 and NXF1. Also associates with polyadenylated mRNAs independently of NXF1. Associates with spliced mRNAs in an exon junction complex (EJC)-dependent manner and seems not to be directly involved in splicing. May be involved in nuclear mRNA export by association with DDX5 and regulating its nuclear location. Involved in innate immune signaling promoting the production of type I interferon (IFN-alpha and IFN-beta); proposed to act as viral RNA sensor, signaling intermediate and transcriptional coactivator. Involved in TBK1 and IKBKE-dependent IRF3 activation leading to IFNB induction, plays a role of scaffolding adapter that links IKBKE and IRF3 and coordinates their activation. Also found associated with IFNB promoters; the function is independent of IRF3. Can bind to viral RNAs and via association with MAVS/IPS1 and DDX58/RIG-I is thought to induce signaling in early stages of infection. Involved in regulation of apoptosis. May be required for activation of the intrinsic but inhibit activation of the extrinsic apoptotic pathway. Acts as an antiapoptotic protein through association with GSK3A/B and BIRC2 in an apoptosis antagonizing signaling complex; activation of death receptors promotes caspase-dependent cleavage of BIRC2 and DDX3X and relieves the inhibition. May be involved in mitotic chromosome segregation. Is an allosteric activator of CSNK1E, it stimulates CSNK1E-mediated phosphorylation of DVL2 and is involved in the positive regulation of canonical Wnt signaling (By similarity).[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...