Constitutive androstane receptor (NR1I3) (NM_001077473) Human Untagged Clone

CAT#: SC315523

NR1I3 (untagged)-Human nuclear receptor subfamily 1, group I, member 3 (NR1I3), transcript variant 12



  "NM_001077473" in other vectors (4)

CNY 6,270.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
NR1I3 mouse monoclonal antibody, clone OTI1C6 (formerly 1C6)
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CAR; CAR1; MB67
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC315523 representing NM_001077473.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGCTGCCTAAGAGAAGCAGGAGAACAGTCAGCAAAAGCATTGGTCCCACCTGCCCCTTTGCTGGAAGC
TGTGAAGTCAGCAAGACTCAGAGGCGCCACTGCCCAGCCTGCAGGTTGCAGAAGTGCTTAGATGCTGGC
ATGAGGAAAGACATGATACTGTCGGCAGAAGCCCTGGCATTGCGGCGAGCAAAGCAGGCCCAGCGGCGG
GCACAGCAAACACCTGTGCAACTGAGTAAGGAGCAAGAAGAGCTGATCCGGACACTCCTGGGGGCCCAC
ACCCGCCACATGGGCACCATGTTTGAACAGTTTGTGCAGTTTAGGCCTCCAGCTCATCTGTTCATCCAT
CACCAGCCCTTGCCCACCCTGGCCCCTGTGCTGCCTCTGGTCACACACTTCGCAGACATCAACACTTTC
ATGGTACTGCAAGTCATCAAGTTTACTAAGGACCTGCCCGTCTTCCGTTCCCTGCCCATTGAAGACCAG
ATCTCCCTTCTCAAGGGAGCAGCTGTGGAAATCTGTCACATCGTACTCAATACCACTTTCTGTCTCCAA
ACACAAAACTTCCTCTGCGGGCCTCTTCGCTACACAATTGAAGATGGAGCCCGTGTATCTCCCACAGTG
GGGTTCCAGGTAGAGTTTTTGGAGTTGCTCTTTCACTTCCATGGAACACTACGAAAACTGCAGCTCCAA
GAGCCTGAGTATGTGCTCTTGGCTGCCATGGCCCTCTTCTCTCCTGCTCCCTATCTTACAGACCGACCT
GGAGTTACCCAGAGAGATGAGATTGATCAGCTGCAAGAGGAGATGGCACTGACTCTGCAAAGCTACATC
AAGGGCCAGCAGCGAAGGCCCCGGGATCGCTCACCTGGAACACCCTGGATACACTGGAGTGGGAAAATG
CTGGGACCAAAGATTGGGCCGGGTTCAAAGGGAGCCCAGTGGTTGCAATGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001077473
Insert Size 948 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001077473.2
RefSeq Size 1120 bp
RefSeq ORF 948 bp
Locus ID 9970
UniProt ID Q14994
Protein Families Druggable Genome, Nuclear Hormone Receptor, Transcription Factors
MW 35.7 kDa
Gene Summary This gene encodes a member of the nuclear receptor superfamily, and is a key regulator of xenobiotic and endobiotic metabolism. The protein binds to DNA as a monomer or a heterodimer with the retinoid X receptor and regulates the transcription of target genes involved in drug metabolism and bilirubin clearance, such as cytochrome P450 family members. Unlike most nuclear receptors, this transcriptional regulator is constitutively active in the absence of ligand but is regulated by both agonists and inverse agonists. Ligand binding results in translocation of this protein to the nucleus, where it activates or represses target gene transcription. These ligands include bilirubin, a variety of foreign compounds, steroid hormones, and prescription drugs. In addition to drug metabolism, the CAR protein is also reported to regulate genes involved in glucose metabolism, lipid metabolism, cell proliferation, and circadian clock regulation. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2020]
Transcript Variant: This variant (12), also known as SV-7, lacks an alternate in-frame exon in the 5' coding region and uses an alternate splice site in the 3' coding region, compared to variant 1. The resulting protein (isoform 12) is shorter, uses an upstream start codon, and has distinct N- and C-termini, compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

其它Constitutive androstane receptor产品

Customer Reviews 
Loading...