MEF2B (NM_001145785) Human Untagged Clone
CAT#: SC326564
MEF2B (untagged)-Human myocyte enhancer factor 2B (MEF2B), mRNA
CNY 5,488.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | RSRFR2 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001145785, the custom clone sequence may differ by one or more nucleotides
ATGGGGAGGAAAAAAATCCAGATCTCCCGCATCCTGGACCAAAGGAATCGGCAGGTGACGTTCACCAAGC GGAAGTTCGGGCTGATGAAGAAGGCCTATGAGCTGAGCGTGCTCTGTGACTGTGAGATAGCCCTCATCAT CTTCAACAGCGCCAACCGCCTCTTCCAGTATGCCAGCACGGACATGGACCGTGTGCTGCTGAAGTACACA GAGTACAGCGAGCCCCACGAGAGCCGCACCAACACTGACATCCTCGAGACGCTGAAGCGGAGGGGCATTG GCCTCGATGGGCCAGAGCTGGAGCCGGATGAAGGGCCTGAGGAGCCAGGAGAGAAGTTTCGGAGGCTGGC AGGCGAAGGGGGTGATCCGGCCTTGCCCCGACCCCGGCTGTATCCTGCAGCTCCTGCTATGCCCAGCCCA GATGTGGTATACGGGGCCTTACCGCCACCAGGCTGTGACCCCAGTGGGCTTGGGGAAGCACTGCCCGCCC AGAGCCGCCCATCTCCCTTCCGACCAGCAGCCCCCAAAGCCGGGCCCCCAGGCCTGGTGCACCCTCTCTT CTCACCAAGCCACCTCACCAGCAAGACACCACCCCCACTGTACCTGCCGACGGAAGGGCGGAGGTCAGAC CTGCCTGGTGGCCTGGCTGGGCCCCGAGGGGGACTAAACACCTCCAGAAGCCTCTACAGTGGCCTGCAGA ACCCCTGCTCCACTGCAACTCCCGGACCCCCACTGGGGAGCTTCCCCTTCCTCCCCGGAGGCCCCCCAGA ATATGGCCTGGGAGACCCTCCACCGCCCCCTGGCTTGTTGCAGCCCCCCACCCTGGCCCCCTGGCAGCCC TCGAGGGGTGATGGGCCCCCCGCCGTGTCCTCCCAGCCCAGTGGGGGCCGAAGCCTGGGCGAGGAGGGTC CCCCAACCCGCGGCGCCTCCCCGCCGACCCCCCCAGTCAGCATCAAGTCTGAGCGCCTCTCTCCGGCCCC CGGGGGCCCCGGCGACTTTCCTAAGACCTTCCCCTATCCCTTGCTCCTCGCCCGGTCCCTGGCAGAGCCT CTGCGGCCTGGGCCCGCCCTGCGCCGGCTGCCCTTGGCCGACGGCTGGCCCCGGTAG |
Restriction Sites | Please inquire |
ACCN | NM_001145785 |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001145785.1, NP_001139257.1 |
RefSeq Size | 1472 bp |
RefSeq ORF | 1107 bp |
Locus ID | 100271849 |
UniProt ID | Q02080 |
Gene Summary | The product of this gene is a member of the MADS/MEF2 family of DNA binding proteins. The protein is thought to regulate gene expression, including expression of the smooth muscle myosin heavy chain gene. This region undergoes considerable alternative splicing, with transcripts supporting two non-overlapping loci (GeneID 729991 and 100271849) as well as numerous read-through transcripts that span both loci (annotated as GeneID 4207). Several isoforms of this protein are expressed from either this locus or from some of the read-through transcripts annotated on GeneID 4207. [provided by RefSeq, Jan 2014] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC227214 | MEF2B (Myc-DDK-tagged)-Human myocyte enhancer factor 2B (MEF2B) |
CNY 5,488.00 |
|
RC227214L3 | Lenti ORF clone of Human myocyte enhancer factor 2B (MEF2B), Myc-DDK-tagged |
CNY 5,890.00 |
|
RC227214L4 | Lenti ORF clone of Human myocyte enhancer factor 2B (MEF2B), mGFP tagged |
CNY 5,890.00 |
|
RG227214 | MEF2B (tGFP-tagged) - Human myocyte enhancer factor 2B (MEF2B) |
CNY 4,370.00 |