Parathyroid hormone related protein (PTHLH) (J03580) Human Untagged Clone
CAT#: SC312224
PTHLH (untagged)-Human, parathyroid-like protein (associated with humoral hypercalcemia of malignancy) mRNA, complete cds
CNY 9,120.00
货期*
4周
规格
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
经常一起买 (4)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | HHM; humoral hypercalcemia of malignancy; MGC14611; osteostatin; parathyroid; parathyroid-like protein; parathyroid hormone-like protein; parathyroid hormone-like related protein; parathyroid hormone-related protein; PLP; PTH-related protein; PTHR; PTHRP |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for J03580, the custom clone sequence may differ by one or more nucleotides
ATGCAGCGGAGACTGGTTCAGCAGTGGAGCGTCGCGGTGTTCCTGCTGAGCTACGCGGTG CCCTCCTGCGGGCGCTCGGTGGAGGGTCTCAGCCGCCGCCTCAAAAGAGCTGTGTCTGAA CATCAGCTCCTCCATGACAAGGGGAAGTCCATCCAAGATTTACGGCGACGATTCTTCCTT CACCATCTGATCGCAGAAATCCACACAGCTGAAATCCACCCCGTCCGATTTGGGTCTGAT GATGAGGGCAGATACCTAACTCAGGAAACTAACAAGGTGGAGACGTACAAAGAGCAGCCG CTCAAGACACCTGGGAAGAAAAAGAAAGGCAAGCCCGGGAAACGCAAGGAGCAGGAAAAG AAAAAACGGCGAACTCGCTCTGCCTGGTTAGACTCTGGAGTGACTGGGAGTGGGCTAGAA GGGGACCACCTGTCTGACACCTCCACAACGTCGCTGGAGCTCGATTCACGGAGGCAT |
Restriction Sites | Please inquire |
ACCN | J03580 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | J03580.1, AAA60216.1 |
RefSeq Size | 1887 bp |
RefSeq ORF | 1887 bp |
Locus ID | 5744 |
Domains | Parathyroid |
Protein Families | Druggable Genome, Secreted Protein |
Gene Summary | The protein encoded by this gene is a member of the parathyroid hormone family. This hormone, via its receptor, PTHR1, regulates endochondral bone development and epithelial-mesenchymal interactions during the formation of the mammary glands and teeth. It is responsible for most cases of humoral hypercalcemia of malignancy, and mutations in this gene are associated with brachydactyly type E2 (BDE2). Alternatively spliced transcript variants have been found for this gene. There is also evidence for alternative translation initiation from non-AUG (CUG and GUG) start sites, downstream of the initiator AUG codon, resulting in nuclear forms of this hormone. [provided by RefSeq, Nov 2013] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Customer
Reviews
Loading...