ABCB4 (NM_018849) Human 3' UTR Clone

CAT#: SC200011

3' UTR clone of ATP-binding cassette sub-family B (MDR/TAP) member 4 (ABCB4) transcript variant B for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name ABCB4 (NM_018849) Human 3' UTR Clone
Vector pMirTarget
Synonyms ABC21; GBD1; ICP3; MDR2; MDR2/3; MDR3; PFIC-3; PGY3
ACCN NM_018849
Insert Size 430 bp
Sequence Data
>SC200011 3’UTR clone of NM_018849
The sequence shown below is from the reference sequence of NM_018849. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
AGTGTCCAGGCTGGGACACAGAACTTATGAACTTTTGCTACAGTATATTTTAAAAATAAATTCAAATTA
TTCTACCATTTTATCTGACTTGTAAAATAAGTTTCTGGTTTGTCATCATAAAACATAGGTATGTCTGTC
TCATTCTAGATCAATTTAGAAGACCCAATTTGGGGTTTATTACGGCATTTGAAATTTGAGAGTTAGAAG
TGACACCTGTCTTGATGAAGTATTGAAACAACAGGCTAGCTCTCCCTAAGTTATTAGAAACATCCAGAA
AAAGAACAAAATTCAAGGTAAGTACAGGTGTAGAAATATAGAAGCCACAGACATAGGGAAATGGTCTTA
TGGTCCTGAATGGGTTGGGTAGACAGGAAAGTTTGGGAATAATTTTCCCAAGTACAAAAGAAAAATAAA
TTGTTCAATAGCCTCA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_018849.3
Synonyms ABC21; GBD1; ICP3; MDR2; MDR2/3; MDR3; PFIC-3; PGY3
Summary The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MDR/TAP subfamily. Members of the MDR/TAP subfamily are involved in multidrug resistance as well as antigen presentation. This gene encodes a full transporter and member of the p-glycoprotein family of membrane proteins with phosphatidylcholine as its substrate. The function of this protein has not yet been determined; however, it may involve transport of phospholipids from liver hepatocytes into bile. Alternative splicing of this gene results in several products of undetermined function. [provided by RefSeq, Jul 2008]
Locus ID 5244
MW 16.9
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...