TRM1 (TRMT1) (NM_001136035) Human 3' UTR Clone

CAT#: SC200022

3' UTR clone of TRM1 tRNA methyltransferase 1 homolog (S. cerevisiae) (TRMT1) transcript variant 2 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name TRM1 (TRMT1) (NM_001136035) Human 3' UTR Clone
Vector pMirTarget
Synonyms MRT68; TRM1
ACCN NM_001136035
Insert Size 58 bp
Sequence Data
>SC200022 3’UTR clone of NM_001136035
The sequence shown below is from the reference sequence of NM_001136035. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GGGGCTGCCGCTGGGCCAGGCATAGACTGAACCAATAAAGAGATGTCACGTCACCTTC
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001136035.4
Synonyms MRT68; TRM1
Summary This gene encodes a tRNA-modifying enzyme that acts as a dimethyltransferase, modifying a single guanine residue at position 26 of the tRNA. The encoded enzyme has both mono- and dimethylase activity when exogenously expressed, and uses S-adenosyl methionine as a methyl donor. The C-terminal region of the encoded protein has both a zinc finger motif, and an arginine/proline-rich region. Mutations in this gene have been implicated in autosomal recessive intellectual disorder (ARID). Alternative splicing results in multiple transcript variants encoding different isoforms. There is a pseudogene of this gene on the X chromosome. [provided by RefSeq, May 2017]
Locus ID 55621
MW 1.9
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...