ZNHIT2 (NM_014205) Human 3' UTR Clone

CAT#: SC200157

3' UTR clone of zinc finger HIT type 2 (ZNHIT2) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name ZNHIT2 (NM_014205) Human 3' UTR Clone
Vector pMirTarget
Synonyms C11orf5; FON
ACCN NM_014205
Insert Size 69 bp
Sequence Data
>SC200157 3’UTR clone of NM_014205
The sequence shown below is from the reference sequence of NM_014205. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
AGAACTCTCATTGAGGAGCTCCCTAGCTGAACGGGTTACCCTGGTCATTAATAAAGCTGTGACTGGTCA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_014205.4
Synonyms C11orf5; FON
Summary May act as a bridging factor mediating the interaction between the R2TP/Prefoldin-like (R2TP/PFDL) complex and U5 small nuclear ribonucleoprotein (U5 snRNP) (PubMed:28561026). Required for the interaction of R2TP complex subunit RPAP3 and prefoldin-like subunit URI1 with U5 snRNP proteins EFTUD2 and PRPF8 (PubMed:28561026). May play a role in regulating the composition of the U5 snRNP complex (PubMed:28561026).[UniProtKB/Swiss-Prot Function]
Locus ID 741
MW 2.6
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...