RNF36 (TRIM69) (NM_080745) Human 3' UTR Clone

CAT#: SC200170

3' UTR clone of tripartite motif-containing 69 (TRIM69) transcript variant b for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name RNF36 (TRIM69) (NM_080745) Human 3' UTR Clone
Vector pMirTarget
Synonyms HSD-34; HSD34; RNF36; Trif
ACCN NM_080745
Insert Size 85 bp
Sequence Data
>SC200170 3’UTR clone of NM_080745
The sequence shown below is from the reference sequence of NM_080745. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GAACCATTGCACATCTTACATCCACAGTAATGAGTCATAATATTATACAAATTCAGAGTGTTATTAAAG
AGGTATTGAAATATTT
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_080745.5
Synonyms HSD-34; HSD34; RNF36; Trif
Summary This gene encodes a member of the RING-B-box-coiled-coil (RBCC) family and encodes a protein with an N-terminal RING finger motif, a PRY domain and a C-terminal SPRY domain. The mouse ortholog of this gene is specifically expressed in germ cells at the round spermatid stages during spermatogenesis and, when overexpressed, induces apoptosis. Alternatively spliced transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Jul 2008]
Locus ID 140691
MW 3.5
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...