RPS4Y1 (NM_001008) Human 3' UTR Clone

CAT#: SC200290

3' UTR clone of ribosomal protein S4 Y-linked 1 (RPS4Y1) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Cited in 1 publication.

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name RPS4Y1 (NM_001008) Human 3' UTR Clone
Vector pMirTarget
Synonyms RPS4Y; S4
ACCN NM_001008
Insert Size 404 bp
Sequence Data
>SC200290 3’UTR clone of NM_001008
The sequence shown below is from the reference sequence of NM_001008. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
AGGCTGGCCACCAAACAGAGCAGTGGCTAAATTGCAGTAGCAGCATATCTTTTTTTCTTTGCACAAATA
AACAGTGAATTCTCGTTTCTTAATGTGTTTTTTCCCCCTTGTGGATAATAGTAGGGTTTGAATTTGCTC
ATGATTTTGGCACTGTCTTAAGATCTCTAGGAATACCACCTATACTTCCTCTGACCCTCCAGTAAATAA
ACCTTTGCTTCCCTCATACATGTTACCCACACCATCTCTGTGGGCAGAGTGATGGAGTAGCATTCCAAA
ACGAAGTACAAAAAACGTATGACATTTCAGAAAGGACGGCATTCTTTTGTGGAAGCTATGGGAGATGGT
CTTAGTTTTCTTGCTTGTTCACATTATTGGTAGAAATTAAATCCTGTGGCTGTAGGAAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001008.4
Synonyms RPS4Y; S4
Summary Cytoplasmic ribosomes, organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes ribosomal protein S4, a component of the 40S subunit. Ribosomal protein S4 is the only ribosomal protein known to be encoded by more than one gene, namely this gene and ribosomal protein S4, X-linked (RPS4X). The 2 isoforms encoded by these genes are not identical, but are functionally equivalent. Ribosomal protein S4 belongs to the S4E family of ribosomal proteins. It has been suggested that haploinsufficiency of the ribosomal protein S4 genes plays a role in Turner syndrome; however, this hypothesis is controversial. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. [provided by RefSeq, Jul 2008]
Locus ID 6192
MW 15.1
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations (1)

Documents

Customer Reviews 
Loading...