C20orf31 (EDEM2) (NM_001145025) Human 3' UTR Clone

CAT#: SC200371

3' UTR clone of ER degradation enhancer mannosidase alpha-like 2 (EDEM2) transcript variant 2 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name C20orf31 (EDEM2) (NM_001145025) Human 3' UTR Clone
Vector pMirTarget
Synonyms bA4204.1; C20orf31; C20orf49
ACCN NM_001145025
Insert Size 99 bp
Sequence Data
>SC200371 3’UTR clone of NM_001145025
The sequence shown below is from the reference sequence of NM_001145025. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CTGGGACAGGTTTTCCTAGACTCCTCATAACCACTGGATAATTTTTTTATTTTTATTTTTTTGAGGCTA
AACTATAATAAATTGCTTTTGGCTATCATA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001145025.2
Synonyms bA4204.1; C20orf31; C20orf49
Summary In the endoplasmic reticulum (ER), misfolded proteins are retrotranslocated to the cytosol and degraded by the proteasome in a process known as ER-associated degradation (ERAD). EDEM2 belongs to a family of proteins involved in ERAD of glycoproteins (Mast et al., 2005 [PubMed 15537790]).[supplied by OMIM, Mar 2008]
Locus ID 55741
MW 3.9
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...