WDR62 (NM_173636) Human 3' UTR Clone

CAT#: SC200389

3' UTR clone of WD repeat domain 62 (WDR62) transcript variant 2 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Cited in 1 publication.

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name WDR62 (NM_173636) Human 3' UTR Clone
Vector pMirTarget
Synonyms C19orf14; MCPH2
ACCN NM_173636
Insert Size 110 bp
Sequence Data
>SC200389 3’UTR clone of NM_173636
The sequence shown below is from the reference sequence of NM_173636. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GCCGTGCGGAGGAAGGCACGGGGGCACTGAGGGCGCAGCCCCTCCACCGCAGCCCTGCTGCTTCTGAGG
ACTTAGGTATTTTAAGCGAATAAACTGACAGCTTTGAGGAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_173636.5
Synonyms C19orf14; MCPH2
Summary This gene is proposed to play a role in cerebral cortical development. Mutations in this gene have been associated with microencephaly, cortical malformations, and cognitive disability. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2011]
Locus ID 284403
MW 4
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations (1)

Documents

Customer Reviews 
Loading...