DPM3 (NM_018973) Human 3' UTR Clone

CAT#: SC200420

3' UTR clone of dolichyl-phosphate mannosyltransferase polypeptide 3 (DPM3) transcript variant 1 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name DPM3 (NM_018973) Human 3' UTR Clone
Vector pMirTarget
Synonyms CDG1O; MDDGB15; MDDGC15
ACCN NM_018973
Insert Size 101 bp
Sequence Data
>SC200420 3’UTR clone of NM_018973
The sequence shown below is from the reference sequence of NM_018973. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GACTTAGCCCGCAGGGGGCTGCGCTTCTGACAGCCTAACCCCATTCCTGTGCGGACAGCCCTTCCTCCC
ATTTCCCATTAAAGAGCCAGTTTATTTTCTAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_018973.4
Synonyms CDG1O; MDDGB15; MDDGC15
Summary Dolichol-phosphate mannose (Dol-P-Man) serves as a donor of mannosyl residues on the lumenal side of the endoplasmic reticulum (ER). Lack of Dol-P-Man results in defective surface expression of GPI-anchored proteins. Dol-P-Man is synthesized from GDP-mannose and dolichol-phosphate on the cytosolic side of the ER by the enzyme dolichyl-phosphate mannosyltransferase. The protein encoded by this gene is a subunit of dolichyl-phosphate mannosyltransferase and acts as a stabilizer subunit of the dolichyl-phosphate mannosyltransferase complex. [provided by RefSeq, Jul 2008]
Locus ID 54344
MW 3.7
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...