XAB2 (NM_020196) Human 3' UTR Clone

CAT#: SC200455

3' UTR clone of XPA binding protein 2 (XAB2) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name XAB2 (NM_020196) Human 3' UTR Clone
Vector pMirTarget
Synonyms HCNP; HCRN; NTC90; SYF1
ACCN NM_020196
Insert Size 91 bp
Sequence Data
>SC200455 3’UTR clone of NM_020196
The sequence shown below is from the reference sequence of NM_020196. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GCAGTGTTTGGGAGCCTGAAGGAAGACTGACCCGTCCCTCCCCCATCCCCCCTCCCCACCCCCTCCCCA
ATACAGCTACGTTTGTACATCA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_020196.3
Synonyms HCNP; HCRN; NTC90; SYF1
Summary Involved in pre-mRNA splicing as component of the spliceosome (PubMed:11991638, PubMed:28502770, PubMed:28076346). Involved in transcription-coupled repair (TCR), transcription and pre-mRNA splicing (PubMed:10944529, PubMed:17981804).[UniProtKB/Swiss-Prot Function]
Locus ID 56949
MW 3.2
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...