FILIP1L (NM_182909) Human 3' UTR Clone

CAT#: SC200494

3' UTR clone of filamin A interacting protein 1-like (FILIP1L) transcript variant 1 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name FILIP1L (NM_182909) Human 3' UTR Clone
Vector pMirTarget
Synonyms DOC-1; DOC1; GIP90; GIP130
ACCN NM_182909
Insert Size 121 bp
Sequence Data
>SC200494 3’UTR clone of NM_182909
The sequence shown below is from the reference sequence of NM_182909. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
ACAGTGGAACCACTTCTTCTGCCTCATTGAACTCAACATCCTTCAGACTTTTAAGGCATTCCAAATCCC
AGTCTTCATGTTGAACTGGGTTAAGCATTTATTAAAAAATCGTTTTCTTCTA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_182909.4
Synonyms DOC-1; DOC1; GIP90; GIP130
Summary Acts as a regulator of the antiangiogenic activity on endothelial cells. When overexpressed in endothelial cells, leads to inhibition of cell proliferation and migration and an increase in apoptosis. Inhibits melanoma growth When expressed in tumor-associated vasculature.[UniProtKB/Swiss-Prot Function]
Locus ID 11259
MW 4.4
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...