PAX3 (NM_013942) Human 3' UTR Clone

CAT#: SC200511

3' UTR clone of paired box 3 (PAX3) transcript variant PAX3B for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name PAX3 (NM_013942) Human 3' UTR Clone
Vector pMirTarget
Synonyms CDHS; HUP2; WS1; WS3
ACCN NM_013942
Insert Size 118 bp
Sequence Data
>SC200511 3’UTR clone of NM_013942
The sequence shown below is from the reference sequence of NM_013942. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GCCCTGGTCTCCGGAGTTTCCTCGCATTAAAGGAGAGAGAGAGAGAGTACTCTTTTGGGCAACGGCCCT
CCAAAATTGCCCCCACATTGGCTGCCTTATAAATATGTCTGTGTGTTGA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_013942.5
Synonyms CDHS; HUP2; WS1; WS3
Summary This gene is a member of the paired box (PAX) family of transcription factors. Members of the PAX family typically contain a paired box domain and a paired-type homeodomain. These genes play critical roles during fetal development. Mutations in paired box gene 3 are associated with Waardenburg syndrome, craniofacial-deafness-hand syndrome, and alveolar rhabdomyosarcoma. The translocation t(2;13)(q35;q14), which represents a fusion between PAX3 and the forkhead gene, is a frequent finding in alveolar rhabdomyosarcoma. Alternative splicing results in transcripts encoding isoforms with different C-termini. [provided by RefSeq, Jul 2008]
Locus ID 5077
MW 4.4
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...