Trophinin (TRO) (NM_016157) Human 3' UTR Clone

CAT#: SC200518

3' UTR clone of trophinin (TRO) transcript variant 3 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name Trophinin (TRO) (NM_016157) Human 3' UTR Clone
Vector pMirTarget
Synonyms MAGE-d3; MAGED3
ACCN NM_016157
Insert Size 123 bp
Sequence Data
>SC200518 3’UTR clone of NM_016157
The sequence shown below is from the reference sequence of NM_016157. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
TATGGCCAATCAGCTGAGGGTGTCATGTGATGGAAAAATCTGTTTGCTGTTCCTGCTTTATTGTTTGCT
TTCTGTGTGCTGTCATATTTTGGTATCAGAGTTACATTAAATTTGCAAAATGAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_016157.4
Synonyms MAGE-d3; MAGED3
Summary This gene encodes a membrane protein that mediates cell adhesion between trophoblastic cells and the epithelial cells of the endometrium. The encoded protein participates in cell signalling during embryo implantation, and may also be involved in cancer formation. This gene is located near several other closely related genes on chromosome X. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2012]
Locus ID 7216
MW 4.6
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...