CENTB1 (ACAP1) (NM_014716) Human 3' UTR Clone

CAT#: SC200526

3' UTR clone of ArfGAP with coiled-coil ankyrin repeat and PH domains 1 (ACAP1) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Cited in 1 publication.

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name CENTB1 (ACAP1) (NM_014716) Human 3' UTR Clone
Vector pMirTarget
Synonyms CENTB1
ACCN NM_014716
Insert Size 112 bp
Sequence Data
>SC200526 3’UTR clone of NM_014716
The sequence shown below is from the reference sequence of NM_014716. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CGTCGCAGTCATGACCTCCACACGCTGTGACCCGAGGCCCACGGGGCCCGCGCCTGCCTCCCTTCCCCG
CCACCGGGCCCTCTGCCATTAAAGCCTCCGTGCTTCGCTCTTC
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_014716.4
Synonyms CENTB1
Summary GTPase-activating protein (GAP) for ADP ribosylation factor 6 (ARF6) required for clathrin-dependent export of proteins from recycling endosomes to trans-Golgi network and cell surface. Required for regulated export of ITGB1 from recycling endosomes to the cell surface and ITGB1-dependent cell migration.[UniProtKB/Swiss-Prot Function]
Locus ID 9744
MW 4
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations (1)

Documents

Customer Reviews 
Loading...