ENO3 (NM_053013) Human 3' UTR Clone

CAT#: SC200601

3' UTR clone of enolase 3 (beta muscle) (ENO3) transcript variant 2 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name ENO3 (NM_053013) Human 3' UTR Clone
Vector pMirTarget
Synonyms GSD13; MSE
ACCN NM_053013
Insert Size 112 bp
Sequence Data
>SC200601 3’UTR clone of NM_053013
The sequence shown below is from the reference sequence of NM_053013. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CGCAAGTTCCGTAACCCGAAGGCCAAGTGAGAAGCTGGAGGCTCCAGGACTCCACTGGACAGACCCAGG
TCTTCCAGACCTGCTTCCTGAAATAAACACTGGTGCCAACCAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_053013.4
Synonyms GSD13; MSE
Summary This gene encodes one of the three enolase isoenzymes found in mammals. This isoenzyme is found in skeletal muscle cells in the adult where it may play a role in muscle development and regeneration. A switch from alpha enolase to beta enolase occurs in muscle tissue during development in rodents. Mutations in this gene have be associated glycogen storage disease. Alternatively spliced transcript variants encoding different isoforms have been described.[provided by RefSeq, Jul 2010]
Locus ID 2027
MW 4.3
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...