FLAD1 (NM_201398) Human 3' UTR Clone

CAT#: SC200618

3' UTR clone of FAD1 flavin adenine dinucleotide synthetase homolog (S. cerevisiae) (FLAD1) transcript variant 2 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name FLAD1 (NM_201398) Human 3' UTR Clone
Vector pMirTarget
Synonyms FAD1; FADS; LSMFLAD; PP591
ACCN NM_201398
Insert Size 104 bp
Sequence Data
>SC200618 3’UTR clone of NM_201398
The sequence shown below is from the reference sequence of NM_201398. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GAAGAAGAGGAGCGGAACTCCCGCACATGACCTCCCACCCTAGGAGGGAGGGAAGGACACCGTCCTAGG
GTATAACCTGGCAATAAACCGTGCCTCTCACTGTG
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_201398.3
Synonyms FAD1; FADS; LSMFLAD; PP591
Summary This gene encodes the enzyme that catalyzes adenylation of flavin mononucleotide (FMN) to form flavin adenine dinucleotide (FAD) coenzyme. Alternatively spliced transcript variants encoding distinct isoforms have been observed. [provided by RefSeq, Jul 2008]
Locus ID 80308
MW 3.8
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...