PAGE4 (NM_007003) Human 3' UTR Clone

CAT#: SC200687

3' UTR clone of P antigen family member 4 (prostate associated) (PAGE4) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Cited in 1 publication.

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name PAGE4 (NM_007003) Human 3' UTR Clone
Vector pMirTarget
Synonyms CT16.7; GAGE-9; GAGEC1; JM-27; JM27; PAGE-1; PAGE-4
ACCN NM_007003
Insert Size 432 bp
Sequence Data
>SC200687 3’UTR clone of NM_007003
The sequence shown below is from the reference sequence of NM_007003. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
ACTAAAGAAGCAGGAGATGGGCAGCCATAAGTTAAAAAGAAGACAAGCTGAAGCTACACACATGGCTGA
TGTCACATTGAAAATGTGACTGAAAATTTGAAAATTCTCTCAATAAAGTTTGAGTTTTCTCTGAAGAAG
TCATGCGTGTCTTTTGTAAAATTTATTCCTAGGAAATTGACACTATTGTAAATGGTATCTTTAAAAAAT
CCTTGTGTTCTGTTTAGAGCTGGTATATATTTTTGTATACTGATTTTGTGTTGGGCAACATTGCTAAAC
TTGCCTATTCTGTTGGTTTATCCCTACGTCCTTTTGGATTTTCTCCATACACAATCATACCACATGTAA
ATAATGATAATTCTGTTTTTTCCTTTTGAGGCTTTGTACTTTCATTTCTGGTCCTTATGACACTGGCCA
GACCCCTCCAGTACAATG
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_007003.4
Synonyms CT16.7; GAGE-9; GAGEC1; JM-27; JM27; PAGE-1; PAGE-4
Summary This gene is a member of the GAGE family. The GAGE genes are expressed in a variety of tumors and in some fetal and reproductive tissues. This gene is strongly expressed in prostate and prostate cancer. It is also expressed in other male and female reproductive tissues including testis, fallopian tube, uterus, and placenta, as well as in testicular cancer and uterine cancer. The protein encoded by this gene shares sequence similarity with other GAGE/PAGE proteins, and also belongs to a family of CT (cancer-testis) antigens. The protein may play a role in benign and malignant prostate diseases. A related pseudogene is located on chromosome 7. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jan 2016]
Locus ID 9506
MW 16.8
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations (1)

Documents

Customer Reviews 
Loading...