CTNNBL1 (NM_030877) Human 3' UTR Clone

CAT#: SC200839

3' UTR clone of catenin beta like 1 (CTNNBL1) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name CTNNBL1 (NM_030877) Human 3' UTR Clone
Vector pMirTarget
Synonyms C20orf33; dJ633O20.1; NAP; P14L; PP8304
ACCN NM_030877
Insert Size 135 bp
Sequence Data
>SC200839 3’UTR clone of NM_030877
The sequence shown below is from the reference sequence of NM_030877. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CGCATCCTGGGCTTGCTGGAGAACTTCTAGAGGCACCTTGGCCCTGCGCATCATGGACTCTCTCAGCTT
CCCTCCCAGGATCAGTTTCTACACAACTCTGTGTGGCTTTTGGACAAATTAAAGCTAGTTTTGGTA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_030877.5
Synonyms C20orf33; dJ633O20.1; NAP; P14L; PP8304
Summary The protein encoded by this gene is a component of the pre-mRNA-processing factor 19-cell division cycle 5-like (PRP19-CDC5L) protein complex, which activates pre-mRNA splicing and is an integral part of the spliceosome. The encoded protein is also a nuclear localization sequence binding protein, and binds to activation-induced deaminase and is important for antibody diversification. This gene may also be associated with the development of obesity. Alternative splicing results in multiple transcript variants. A pseudogene of this gene has been defined on the X chromosome. [provided by RefSeq, Jul 2013]
Locus ID 56259
MW 5.2
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...