CD3D (NM_000732) Human 3' UTR Clone

CAT#: SC200887

3' UTR clone of CD3d molecule delta (CD3-TCR complex) (CD3D) transcript variant 1 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name CD3D (NM_000732) Human 3' UTR Clone
Vector pMirTarget
Synonyms CD3-DELTA; IMD19; T3D
ACCN NM_000732
Insert Size 117 bp
Sequence Data
>SC200887 3’UTR clone of NM_000732
The sequence shown below is from the reference sequence of NM_000732. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CTTGGAGGAAACTGGGCTCGGAACAAGTGAACCTGAGACTGGTGGCTTCTAGAAGCAGCCATTACCAAC
TGTACCTTCCCTTCTTGCTCAGCCAATAAATATATCCTCTTTCACTCA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_000732.6
Synonyms CD3-DELTA; IMD19; T3D
Summary The protein encoded by this gene is part of the T-cell receptor/CD3 complex (TCR/CD3 complex) and is involved in T-cell development and signal transduction. The encoded membrane protein represents the delta subunit of the CD3 complex, and along with four other CD3 subunits, binds either TCR alpha/beta or TCR gamma/delta to form the TCR/CD3 complex on the surface of T-cells. Defects in this gene are a cause of severe combined immunodeficiency autosomal recessive T-cell-negative/B-cell-positive/NK-cell-positive (SCIDBNK). Two transcript variants encoding different isoforms have been found for this gene. Other variants may also exist, but the full-length natures of their transcripts has yet to be defined. [provided by RefSeq, Feb 2009]
Locus ID 915
MW 4.5
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...