COX7B (NM_001866) Human 3' UTR Clone

Specifications

Product Data
Product Name	COX7B (NM_001866) Human 3' UTR Clone
Vector	pMirTarget
Synonyms	APLCC; LSDMCA2
ACCN	NM_001866
Insert Size	142 bp
Sequence Data	Insert Sequence (showhide) >SC200962 3' UTR clone of NM_001866 The sequence shown below is from the reference sequence of NM_001866. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon CAATTGGCAGAGCTCAGAATTCAAGCGATCGC CCTGTTGGCAGAGTTACCCCAAAGGAATGGAGGAATCAGTAATCATCCCAGCTGGTGTAATAATGAATTG TTTAAAAAACAGCTCATAATTGATGCCAAATTAAAGCACTGTGTACCCATTAAGATATGGCATTATTGAA GA ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites	SgfI-MluI
OTI Disclaimer	Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq	NM_001866.2
Synonyms	APLCC; LSDMCA2
Summary	Cytochrome c oxidase (COX), the terminal component of the mitochondrial respiratory chain, catalyzes the electron transfer from reduced cytochrome c to oxygen. This component is a heteromeric complex consisting of 3 catalytic subunits encoded by mitochondrial genes and multiple structural subunits encoded by nuclear genes. The mitochondrially-encoded subunits function in electron transfer, and the nuclear-encoded subunits may function in the regulation and assembly of the complex. This nuclear gene encodes subunit VIIb, which is highly similar to bovine COX VIIb protein and is found in all tissues. This gene may have several pseudogenes on chromosomes 1, 2, 20 and 22. [provided by RefSeq, Jun 2011]
Locus ID	1349

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.