C4orf27 (HPF1) (NM_017867) Human 3' UTR Clone

CAT#: SC201015

3' UTR clone of chromosome 4 open reading frame 27 (C4orf27) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Cited in 1 publication.

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name C4orf27 (HPF1) (NM_017867) Human 3' UTR Clone
Vector pMirTarget
Synonyms C4orf27
ACCN NM_017867
Insert Size 138 bp
Sequence Data
>SC201015 3’UTR clone of NM_017867
The sequence shown below is from the reference sequence of NM_017867. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CAAGAGAACATAGACCAACTTGCTGCATGAGTAAGGTGGCTTTGATTGGTGTACAGTATTTCAAAGGAC
TAGTATTAAACTTGTGATTTTTGTTTTGTTTTTAAGGAATACAAAAAATAAACATTTACTAAAAACGTT
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_017867.3
Synonyms C4orf27
Summary Acts as a cofactor for serine ADP-ribosylation by conferring serine specificity on PARP1 and PARP2: interacts with PARP1 and PARP2 and is able to change amino acid specificity toward serine (PubMed:28190768, PubMed:29480802). Promotes histone serine ADP-ribosylation in response to DNA damage, limiting DNA damage-induced PARP1 hyper-automodification, and ensuring genome stability (PubMed:27067600, PubMed:28190768). Serine ADP-ribosylation of proteins constitutes the primary form of ADP-ribosylation of proteins in response to DNA damage (PubMed:29480802). HPF1 also promotes tyrosine ADP-ribosylation, probably by conferring tyrosine specificity on PARP1 (PubMed:30257210).[UniProtKB/Swiss-Prot Function]
Locus ID 54969
MW 5.6
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations (1)

Documents

Customer Reviews 
Loading...