Hemoglobin subunit delta (HBD) (NM_000519) Human 3' UTR Clone

CAT#: SC201174

3' UTR clone of hemoglobin delta (HBD) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name Hemoglobin subunit delta (HBD) (NM_000519) Human 3' UTR Clone
Vector pMirTarget
ACCN NM_000519
Insert Size 156 bp
Sequence Data
>SC201174 3’UTR clone of NM_000519
The sequence shown below is from the reference sequence of NM_000519. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GCTAATGCCCTGGCTCACAAGTACCATTGAGATCCTGGACTGTTTCCTGATAACCATAAGAAGACCCTA
TTTCCCTAGATTCTATTTTCTGAACTTGGGAACACAATGCCTACTTCAAGGGTATGGCTTCTGCCTAAT
AAAGAATGTTCAGCTCAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_000519.4
Summary The delta (HBD) and beta (HBB) genes are normally expressed in the adult: two alpha chains plus two beta chains constitute HbA, which in normal adult life comprises about 97% of the total hemoglobin. Two alpha chains plus two delta chains constitute HbA-2, which with HbF comprises the remaining 3% of adult hemoglobin. Five beta-like globin genes are found within a 45 kb cluster on chromosome 11 in the following order: 5'-epsilon--Ggamma--Agamma--delta--beta-3'. Mutations in the delta-globin gene are associated with beta-thalassemia. [provided by RefSeq, Jul 2008]
Locus ID 3045
MW 5.9
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...