Galectin 10 (CLC) (NM_001828) Human 3' UTR Clone

CAT#: SC201181

3' UTR clone of Charcot-Leyden crystal protein (CLC) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name Galectin 10 (CLC) (NM_001828) Human 3' UTR Clone
Vector pMirTarget
Synonyms Gal-10; GAL10; LGALS10; LGALS10A; LPPL_HUMAN
ACCN NM_001828
Insert Size 155 bp
Sequence Data
>SC201181 3’UTR clone of NM_001828
The sequence shown below is from the reference sequence of NM_001828. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
AAATTTAATGTCAGCTATTTAAAGAGATAACCAGACTTCATGTTGCCAAGGAATCCCTGTCTCTACGTG
AACTTGGGATTCCAAAGCCAGCTAACAGCATGATCTTTTCTCACTTCAATCCTTACTCCTGCTCATTAA
AACTTAATCAAACTTCA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001828.6
Synonyms Gal-10; GAL10; LGALS10; LGALS10A; LPPL_HUMAN
Summary Lysophospholipases are enzymes that act on biological membranes to regulate the multifunctional lysophospholipids. The protein encoded by this gene is a lysophospholipase expressed in eosinophils and basophils. It hydrolyzes lysophosphatidylcholine to glycerophosphocholine and a free fatty acid. This protein may possess carbohydrate or IgE-binding activities. It is both structurally and functionally related to the galectin family of beta-galactoside binding proteins. It may be associated with inflammation and some myeloid leukemias. [provided by RefSeq, Jul 2008]
Locus ID 1178
MW 5.9
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...