SMARCD3 (NM_003078) Human 3' UTR Clone

CAT#: SC201360

3' UTR clone of SWI/SNF related matrix associated actin dependent regulator of chromatin subfamily d member 3 (SMARCD3) transcript variant 2



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name SMARCD3 (NM_003078) Human 3' UTR Clone
Vector pMirTarget
Synonyms BAF60C; CRACD3; Rsc6p
ACCN NM_003078
Insert Size 353 bp
Sequence Data
>SC201360 3’UTR clone of NM_003078
The sequence shown below is from the reference sequence of NM_003078. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GAGCAGTCGCTGGTTGTGCGCAACACCTAGGAGCCCAAAAATAAGCAGCACGACGGAACTTTCAGCCGT
GTCCCGGGCCCCAGCATTTTGCCCCGGGCTCCAGCATCACTCCTCTGCCACCTTGGGGTGTGGGGCTGG
ATTAAAAGTCATTCATCTGACAGCAGCCGTGTGGTCATTGGAAACTGGGGAGGGGAGGGGGAGAGAAGG
GGAAGGGAAGAAGGTGGGGAGGCAGTGGGTCCCTCGGGACGACTCCCCATTCCCTTCCCTTGGATTCTT
CTCCTTACTCAATTTTCCCTAGACCTAAAAACAGTTTGGCAGAAGACATGTTTAATAACATTTTCATAT
TTAAAAAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_003078.4
Synonyms BAF60C; CRACD3; Rsc6p
Summary The protein encoded by this gene is a member of the SWI/SNF family of proteins, whose members display helicase and ATPase activities and which are thought to regulate transcription of certain genes by altering the chromatin structure around those genes. The encoded protein is part of the large ATP-dependent chromatin remodeling complex SNF/SWI and has sequence similarity to the yeast Swp73 protein. Multiple alternatively spliced transcript variants have been found for this gene, but the biological validity of some variants has not been determined. [provided by RefSeq, Jul 2008]
Locus ID 6604
MW 13
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...