TROY (TNFRSF19) (NM_018647) Human 3' UTR Clone

CAT#: SC201380

3' UTR clone of tumor necrosis factor receptor superfamily member 19 (TNFRSF19) transcript variant 1 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name TROY (TNFRSF19) (NM_018647) Human 3' UTR Clone
Vector pMirTarget
Synonyms TAJ; TAJ-alpha; TRADE; TROY
ACCN NM_018647
Insert Size 177 bp
Sequence Data
>SC201380 3’UTR clone of NM_018647
The sequence shown below is from the reference sequence of NM_018647. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CAGGTAAGGCAGCGACTGGGTTCCCTGTGAACACAGCACTGACTTACAGTAGATCAGAACTCTGTTCCC
AGCATAAGATTTGGGGGAACCTGATGAGTTTTTTTTTTGCATCTTTAATAATTTCTTGTATGTTGTAGA
GTATGTTTTAAAATAAATTTCAAGTATTTTTTTAAAAAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_018647.5
Synonyms TAJ; TAJ-alpha; TRADE; TROY
Summary The protein encoded by this gene is a member of the TNF-receptor superfamily. This receptor is highly expressed during embryonic development. It has been shown to interact with TRAF family members, and to activate JNK signaling pathway when overexpressed in cells. This receptor is capable of inducing apoptosis by a caspase-independent mechanism, and it is thought to play an essential role in embryonic development. Alternatively spliced transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Jul 2008]
Locus ID 55504
MW 7
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...