ZIM2 (NM_001146326) Human 3' UTR Clone

CAT#: SC201382

3' UTR clone of zinc finger imprinted 2 (ZIM2) transcript variant 2 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name ZIM2 (NM_001146326) Human 3' UTR Clone
Vector pMirTarget
Synonyms ZNF656
ACCN NM_001146326
Insert Size 171 bp
Sequence Data
>SC201382 3’UTR clone of NM_001146326
The sequence shown below is from the reference sequence of NM_001146326. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GAGAAAACTGTTGAGTGCGATCACTGTTGAGAAACCTTTAGTCACAGCACACACTTTTCTCAACATTAT
TGGCTTCCTCCTAGAGTGTTGTGAGTGTGAGAAGGCCTTTCACTAGCCCCACCTTGTTAACAACTTGAA
CATTCATCAAAGTGTGGTAAAAAAAAAAAAAAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001146326.2
Synonyms ZNF656
Summary In human, ZIM2 and PEG3 (GeneID:5178) are two distinct genes that share a set of 5' exons and have a common promoter, and both genes are paternally expressed. Alternative splicing events connect the shared exons either with the remaining 4 exons unique to ZIM2, or with the remaining 2 exons unique to PEG3. This is in contrast to mouse and cow, where ZIM2 and PEG3 genes do not share exons in common, and the imprinting status of ZIM2 is also not conserved amongst mammals. Additional 5' alternatively spliced transcripts encoding the same protein have been found for the human ZIM2 gene. [provided by RefSeq, Oct 2010]
Locus ID 23619
MW 6.6
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...