TCP1 theta (CCT8) (NM_006585) Human 3' UTR Clone

CAT#: SC201388

3' UTR clone of chaperonin containing TCP1 subunit 8 (theta) (CCT8) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name TCP1 theta (CCT8) (NM_006585) Human 3' UTR Clone
Vector pMirTarget
Synonyms C21orf112; Cctq; D21S246; PRED71
ACCN NM_006585
Insert Size 179 bp
Sequence Data
>SC201388 3’UTR clone of NM_006585
The sequence shown below is from the reference sequence of NM_006585. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
AAAGACTGGGATGATGACCAAAATGATTGAAATTGGCTTAATTTTTACTGTAGGTGAAGGCTGTATTTG
TAGTAGTACTCAAGAATCACCTGATGTTTTCTTATTCTCCTTAAATTAAGAGTTATTTTGTGTTTGTAT
TCTTGGCTGGATGTTATAATAAACATATTGTTACTGTCAAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_006585.4
Synonyms C21orf112; Cctq; D21S246; PRED71
Summary This gene encodes the theta subunit of the CCT chaperonin, which is abundant in the eukaryotic cytosol and may be involved in the transport and assembly of newly synthesized proteins. Alternative splicing results in multiple transcript variants of this gene. A pseudogene related to this gene is located on chromosome 1. [provided by RefSeq, Sep 2013]
Locus ID 10694
MW 7.3
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...