GATA1 (NM_002049) Human 3' UTR Clone

CAT#: SC201690

3' UTR clone of GATA binding protein 1 (globin transcription factor 1) (GATA1) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name GATA1 (NM_002049) Human 3' UTR Clone
Vector pMirTarget
Synonyms ERYF1; GATA-1; GF-1; GF1; NF-E1; NFE1; XLANP; XLTDA; XLTT
ACCN NM_002049
Insert Size 177 bp
Sequence Data
>SC201690 3’UTR clone of NM_002049
The sequence shown below is from the reference sequence of NM_002049. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
ACTACTGTGGTGGCTCCGCTCAGCTCATGAGGGCACAGAGCATGGCCTCCAGAGGAGGGGTGGTGTCCT
TCTCCTCTTGTAGCCAGAATTCTGGACAACCCAAGTCTCTGGGCCCCAGGCACCCCCTGGCTTGAACCT
TCAAAGCTTTTGTAAAATAAAACCACCAAAGTCCTGAAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_002049.4
Synonyms ERYF1; GATA-1; GF-1; GF1; NF-E1; NFE1; XLANP; XLTDA; XLTT
Summary This gene encodes a protein which belongs to the GATA family of transcription factors. The protein plays an important role in erythroid development by regulating the switch of fetal hemoglobin to adult hemoglobin. Mutations in this gene have been associated with X-linked dyserythropoietic anemia and thrombocytopenia. [provided by RefSeq, Jul 2008]
Locus ID 2623
MW 6.5
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...