TUBB8 (NM_001164154) Human 3' UTR Clone

CAT#: SC201731

3' UTR clone of tubulin beta 8 (TUBB8) transcript variant 2 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name TUBB8 (NM_001164154) Human 3' UTR Clone
Vector pMirTarget
Synonyms FLJ40100; RP11-631M21.2
ACCN NM_001164154
Insert Size 199 bp
Sequence Data
>SC201731 3’UTR clone of NM_001164154
The sequence shown below is from the reference sequence of NM_001164154. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GAGGAGTATGCCGAGGAGGAGGTGGCCTAGAACTCTCCTTTTCTAGGTAAAGGGGGGAAGCAGTGTGGA
TTCTTTACTGTGTTCTGACAGCCATGTGTCACTATACGCTTGTTAATTTGTGTCTTCACATCTCCTGCT
GCGTTTTAAAGCATTTTTATAGTATGCGGTTTTGACTAATAAAGTATTCTCACAGCATCTG
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001164154.1
Synonyms FLJ40100; RP11-631M21.2
Summary The protein encoded by this gene represents the primary beta-tubulin subunit of oocytes and the early embryo. Defects in this gene, which is primate-specific, are a cause of oocyte maturation defect 2 and infertility. [provided by RefSeq, Mar 2016]
Locus ID 347688
MW 7.2
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...