VIRMA (NM_183009) Human 3' UTR Clone

CAT#: SC201980

3' UTR clone of KIAA1429 (KIAA1429) transcript variant 2 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name VIRMA (NM_183009) Human 3' UTR Clone
Vector pMirTarget
Synonyms fSAP121; KIAA1429; MSTP054
ACCN NM_183009
Insert Size 183 bp
Sequence Data
>SC201980 3’UTR clone of NM_183009
The sequence shown below is from the reference sequence of NM_183009. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CTTATAAATGACTGCAGTAACACTTTTTAAAAAGCCAGTGATTTTGTTAAAAAACAAAAACCCTCATCT
CCCTTCCTCCCAAAAAGACATAAAATAACCGGATGAGGGGGAGATAAAACTGAAACAAGTTGGTCATTG
AGGAAATATGGGGGTAACATTTTAAATAAATTTTTGTTAAAGTGA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_183009.3
Synonyms fSAP121; KIAA1429; MSTP054
Summary Associated component of the WMM complex, a complex that mediates N6-methyladenosine (m6A) methylation of RNAs, a modification that plays a role in the efficiency of mRNA splicing and RNA processing (PubMed:24981863, PubMed:29507755). Acts as a key regulator of m6A methylation by promoting m6A methylation of mRNAs in the 3' UTR near the stop codon: recruits the catalytic core components METTL3 and METTL14, thereby guiding m6A methylation at specific sites (PubMed:29507755). Required for mRNA polyadenylation via its role in selective m6A methylation: m6A methylation of mRNAs in the 3' UTR near the stop codon correlating with alternative polyadenylation (APA) (PubMed:29507755).[UniProtKB/Swiss-Prot Function]
Locus ID 25962
MW 6.8
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...