KIAA0020 (PUM3) (NM_014878) Human 3' UTR Clone

CAT#: SC202042

3' UTR clone of KIAA0020 (KIAA0020) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name KIAA0020 (PUM3) (NM_014878) Human 3' UTR Clone
Vector pMirTarget
Synonyms HA-8; HLA-HA8; KIAA0020; PEN; PUF-A; PUF6; XTP5
ACCN NM_014878
Insert Size 203 bp
Sequence Data
>SC202042 3' UTR clone of NM_014878
The sequence shown below is from the reference sequence of NM_014878. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

GCACCAGCAAAGGAATAGAAATTCTACTTGAAAAACTGAGCACATAGGTGGAAAGAGTTAAGAGCAAGAT
GGAATGATTTTTTCTGTTCTCTGTTCTGTTTCCCAATGCAGAAAAGAAGGGGTAGGGTCCACCATACTGG
TAATTGGGGTACTCTGTATATGTGTTTCTTCTTTGTATACGAATCTATTTATATAAATTGTTT

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_014878.4
Synonyms HA-8; HLA-HA8; KIAA0020; PEN; PUF-A; PUF6; XTP5
Summary Inhibits the poly(ADP-ribosyl)ation activity of PARP1 and the degradation of PARP1 by CASP3 following genotoxic stress (PubMed:21266351). Binds to double-stranded RNA or DNA without sequence specificity (PubMed:25512524). Involved in development of the eye and of primordial germ cells (By similarity).[UniProtKB/Swiss-Prot Function]
Locus ID 9933
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...