Cyclophilin E (PPIE) (NM_203456) Human 3' UTR Clone

CAT#: SC202043

3' UTR clone of peptidylprolyl isomerase E (cyclophilin E) (PPIE) transcript variant 2 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name Cyclophilin E (PPIE) (NM_203456) Human 3' UTR Clone
Vector pMirTarget
Synonyms CYP-33; CYP33
ACCN NM_203456
Insert Size 202 bp
Sequence Data
>SC202043 3’UTR clone of NM_203456
The sequence shown below is from the reference sequence of NM_203456. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
AGCCAGCCGAGGTCCTGGAAGCTGACGTAGAGCTCGTGCCGACGGCAGACCTGCCGGCCGTGGGAGCCG
TGGACGTCATCTGCAGGGACAGAAGGGGCAAGGTCTTTTCTGGGGTTCCTACTGTGTGCAGCTACTATG
GGGTACCAGGGTGGGGGATGCCCTGATGAGCACATTTGTCAAATAAATGAATGACAGGAAACCA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_203456.3
Synonyms CYP-33; CYP33
Summary The protein encoded by this gene is a member of the peptidyl-prolyl cis-trans isomerase (PPIase) family. PPIases catalyze the cis-trans isomerization of proline imidic peptide bonds in oligopeptides and accelerate the folding of proteins. This protein contains a highly conserved cyclophilin (CYP) domain as well as an RNA-binding domain. It was shown to possess PPIase and protein folding activities, and it also exhibits RNA-binding activity. Alternative splicing results in multiple transcript variants. A related pseudogene, which is also located on chromosome 1, has been identified. [provided by RefSeq, Aug 2010]
Locus ID 10450
MW 7.4
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...