PRSS57 (NM_214710) Human 3' UTR Clone

CAT#: SC202063

3' UTR clone of protease serine-like 1 (PRSSL1) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name PRSS57 (NM_214710) Human 3' UTR Clone
Vector pMirTarget
Synonyms NSP4; PRSSL1; UNQ782
ACCN NM_214710
Insert Size 200 bp
Sequence Data
>SC202063 3’UTR clone of NM_214710
The sequence shown below is from the reference sequence of NM_214710. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
ACCACCAGGCCCCCAGGAGAAGCCGCCTGAGCCACAACCTTGCGGCATGCAAATGAGATGGCCGCTCCA
GGCCTGGAATGTTCCGTGGCTGGGCCCCACGGGAAGCCTGATGTTCAGGGTTGGGGTGGGACGGGCAGC
GGTGGGGCACACCCATTCCACATGCAAAGGGCAGAAGCAAACCCAGTAAAATGTTAACTGAC
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_214710.5
Synonyms NSP4; PRSSL1; UNQ782
Summary This gene encodes an arginine-specific serine protease and member of the peptidase S1 family of proteins. The encoded protein may undergo proteolytic activation before storage in azurophil granules, in neutrophil cells of the immune system. Following neutrophil activation, the protease is released into the pericellular environment, where it may play a role in defense against microbial pathogens. [provided by RefSeq, Jul 2016]
Locus ID 400668
MW 6.7
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...