TBL1Y (NM_134259) Human 3' UTR Clone

CAT#: SC202074

3' UTR clone of transducin (beta)-like 1Y-linked (TBL1Y) transcript variant 3 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name TBL1Y (NM_134259) Human 3' UTR Clone
Vector pMirTarget
Synonyms DFNY2; TBL1
ACCN NM_134259
Insert Size 221 bp
Sequence Data
>SC202074 3’UTR clone of NM_134259
The sequence shown below is from the reference sequence of NM_134259. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GATGGCTCTGTGTGTGTTCTGGATCTGTGAAAGTAAACACAAAATATAGAAAAAAAGAAAAGAATTCTA
ATGACCTGCCTTGAATGCATGGGGTTGCAGCTCTGTTCAAACACAATTCTATCAGCTCCAAAATGTGTG
AACTTGACTTGTGTTAGAGTATATTCTGAAACCAACTTGTCCCAGGCCACAGGAGTGTATATGTTTCAT
AATCTTTATCAAGA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_134259.2
Synonyms DFNY2; TBL1
Summary The protein encoded by this gene has sequence similarity with members of the WD40 repeat-containing protein family. The WD40 group is a large family of proteins, which appear to have a regulatory function. It is believed that the WD40 repeats mediate protein-protein interactions and members of the family are involved in signal transduction, RNA processing, gene regulation, vesicular trafficking, cytoskeletal assembly and may play a role in the control of cytotypic differentiation. This gene is highly similar to TBL1X gene in nucleotide sequence and protein sequence, but the TBL1X gene is located on chromosome X and this gene is on chromosome Y. This gene has three alternatively spliced transcript variants encoding the same protein. [provided by RefSeq, Jul 2008]
Locus ID 90665
MW 8.2
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...