KAP1 (TRIM28) (NM_005762) Human 3' UTR Clone

CAT#: SC202088

3' UTR clone of tripartite motif-containing 28 (TRIM28) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 5,464.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name KAP1 (TRIM28) (NM_005762) Human 3' UTR Clone
Vector pMirTarget
Synonyms KAP1; PPP1R157; RNF96; TF1B; TIF1B
ACCN NM_005762
Insert Size 182 bp
Sequence Data
>SC202088 3' UTR clone of NM_005762
The sequence shown below is from the reference sequence of NM_005762. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

TGAGTTCCCAGGAGCTGTCTGGTGGCCCTGGTGATGGCCCCTGAGGCTGGAGCCCCCATGGCCAGCCCAG
CCTGGCTCTGTTCTCTGTCCTGTCACCCCATCCCCACTCCCCTGGTGGCCTGACTCCCACTCCCTGGTGG
CCCCATCCCCCAGTTCCTCACGATATGGTTTTTACTTCTGTG

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_005762.2
Synonyms KAP1; PPP1R157; RNF96; TF1B; TIF1B
Summary The protein encoded by this gene mediates transcriptional control by interaction with the Kruppel-associated box repression domain found in many transcription factors. The protein localizes to the nucleus and is thought to associate with specific chromatin regions. The protein is a member of the tripartite motif family. This tripartite motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. [provided by RefSeq, Jul 2008]
Locus ID 10155
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...