NME2 (NME1-NME2) (NM_001018136) Human 3' UTR Clone

CAT#: SC202138

3' UTR clone of NME1-NME2 readthrough transcript (NME1-NME2) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name NME2 (NME1-NME2) (NM_001018136) Human 3' UTR Clone
Vector pMirTarget
Synonyms NM23-LV; NMELV
ACCN NM_001018136
Insert Size 170 bp
Sequence Data
>SC202138 3’UTR clone of NM_001018136
The sequence shown below is from the reference sequence of NM_001018136. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
TCTTGTGCTCATGACTGGGTCTATGAATAAGAGGTGGACACAACAGCAGTCTCCTTCAGCACGGCGTGG
TGTGTCCCTGGACACAGCTCTTCATTCCATTGACTTAGAGGCAACAGGATTGATCATTCTTTTATAGAG
CATATTTGCCAATAAAGCTTTTGGAAGCCGGA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001018136.3
Synonyms NM23-LV; NMELV
Summary This locus represents naturally occurring read-through transcription between the neighboring NME1 and NME2 genes. The significance of this read-through transcription and the function of the resulting protein product have not yet been determined. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Nov 2010]
Locus ID 654364
MW 6.5
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...