PECI (ECI2) (NM_001166010) Human 3' UTR Clone

CAT#: SC202185

3' UTR clone of peroxisomal D3D2-enoyl-CoA isomerase (PECI) transcript variant 3 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name PECI (ECI2) (NM_001166010) Human 3' UTR Clone
Vector pMirTarget
Synonyms ACBD2; dJ1013A10.3; DRS-1; DRS1; HCA88; PECI
ACCN NM_001166010
Insert Size 198 bp
Sequence Data
>SC202185 3’UTR clone of NM_001166010
The sequence shown below is from the reference sequence of NM_001166010. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
AACTTCTTATCCAGAAAATCAAAACTGTGATGACCACTACAGCAGAGTAAAGCATGTCCAAGGAAGGAT
GTGCTGTTACCTCTGATTTCCAGTACTGGAACTAAATAAGCTTCATTGTGCCTTTTGTAGTGCTAGAAT
ATCAATTACAATGATGATATTTCACTACAGCTCTGATGAATAAAAAGTTTTGTAAAACAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001166010.2
Synonyms ACBD2; dJ1013A10.3; DRS-1; DRS1; HCA88; PECI
Summary This gene encodes a member of the hydratase/isomerase superfamily. The protein encoded is a key mitochondrial enzyme involved in beta-oxidation of unsaturated fatty acids. It catalyzes the transformation of 3-cis and 3-trans-enoyl-CoA esters arising during the stepwise degradation of cis-, mono-, and polyunsaturated fatty acids to the 2-trans-enoyl-CoA intermediates. Alternatively spliced transcript variants have been described. [provided by RefSeq, Aug 2011]
Locus ID 10455
MW 7.4
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...