CD98 (SLC3A2) (NM_001012664) Human 3' UTR Clone

CAT#: SC202208

3' UTR clone of solute carrier family 3 (activators of dibasic and neutral amino acid transport) member 2 (SLC3A2) transcript variant 5 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name CD98 (SLC3A2) (NM_001012664) Human 3' UTR Clone
Vector pMirTarget
Synonyms 4F2; 4F2HC; 4T2HC; CD98; CD98HC; MDU1; NACAE
ACCN NM_001012664
Insert Size 197 bp
Sequence Data
>SC202208 3’UTR clone of NM_001012664
The sequence shown below is from the reference sequence of NM_001012664. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CTGCTGCTCCGCTTCCCCTACGCGGCCTGACTTCAGCCTGACATGGACCCACTACCCTTCTCCTTTCCT
TCCCAGGCCCTTTGGCTTCTGATTTTTCTCTTTTTTAAAAACAAACAAACAAACTGTTGCAGATTATGA
GTGAACCCCCAAATAGGGTGTTTTCTGCCTTCAAATAAAAGTCACCCCTGCATGGTGAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001012664.3
Synonyms 4F2; 4F2HC; 4T2HC; CD98; CD98HC; MDU1; NACAE
Summary This gene is a member of the solute carrier family and encodes a cell surface, transmembrane protein. The protein exists as the heavy chain of a heterodimer, covalently bound through di-sulfide bonds to one of several possible light chains. The encoded transporter plays a role in regulation of intracellular calcium levels and transports L-type amino acids. Alternatively spliced transcript variants, encoding different isoforms, have been characterized. [provided by RefSeq, Nov 2010]
Locus ID 6520
MW 7.5
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...