SIRT4 (NM_012240) Human 3' UTR Clone

CAT#: SC202362

3' UTR clone of sirtuin (silent mating type information regulation 2 homolog) 4 (S. cerevisiae) (SIRT4) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name SIRT4 (NM_012240) Human 3' UTR Clone
Vector pMirTarget
Synonyms SIR2L4
ACCN NM_012240
Insert Size 243 bp
Sequence Data
>SC202362 3’UTR clone of NM_012240
The sequence shown below is from the reference sequence of NM_012240. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GAGTTGCTGCCTTTGATAGACCCATGCTGACCACAGCCTGATATTCCAGAACCTGGAACAGGGACTTTC
ACTTGAATCTTGCTGCTAAATGTAAATGCCTTCTCAAATGACAGATTCCAGTTCCCATTCAACAGAGTA
GGGTGCACTGACAAAGTATAGAAGGTTCTAGGTATCTTAATGTGTGGATATTCTTAATTAAAACTCATT
TTTTTTAAATAAAAAATTGTTCAGCTTTATATGAAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_012240.3
Synonyms SIR2L4
Summary This gene encodes a member of the sirtuin family of proteins, homologs to the yeast Sir2 protein. Members of the sirtuin family are characterized by a sirtuin core domain and grouped into four classes. The functions of human sirtuins have not yet been determined; however, yeast sirtuin proteins are known to regulate epigenetic gene silencing and suppress recombination of rDNA. Studies suggest that the human sirtuins may function as intracellular regulatory proteins with mono-ADP-ribosyltransferase activity. The protein encoded by this gene is included in class IV of the sirtuin family. [provided by RefSeq, Jul 2008]
Locus ID 23409
MW 9.2
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...