Myosin (MYH2) (NM_017534) Human 3' UTR Clone

CAT#: SC202382

3' UTR clone of myosin heavy chain 2 skeletal muscle adult (MYH2) transcript variant 1 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name Myosin (MYH2) (NM_017534) Human 3' UTR Clone
Vector pMirTarget
Synonyms IBM3; MYH2A; MYHas8; MyHC-2A; MyHC-IIa; MYHSA2; MYPOP
ACCN NM_017534
Insert Size 162 bp
Sequence Data
>SC202382 3’UTR clone of NM_017534
The sequence shown below is from the reference sequence of NM_017534. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GTTCACACAAAAGTCATAAGTGAAGAGTGATCATGTCCTGATGCCATGGAATGACTGAAGACAGGCACA
AAATGTGACATCTTTGGTCATTTCCCTCTGTAATTATTGTGTATTCTACCCTGTTGCAAAGGAAATAAA
GCATAGGGTAGTTTGCAAACAATA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_017534.6
Synonyms IBM3; MYH2A; MYHas8; MyHC-2A; MyHC-IIa; MYHSA2; MYPOP
Summary Myosins are actin-based motor proteins that function in the generation of mechanical force in eukaryotic cells. Muscle myosins are heterohexamers composed of 2 myosin heavy chains and 2 pairs of nonidentical myosin light chains. This gene encodes a member of the class II or conventional myosin heavy chains, and functions in skeletal muscle contraction. This gene is found in a cluster of myosin heavy chain genes on chromosome 17. A mutation in this gene results in inclusion body myopathy-3. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Sep 2009]
Locus ID 4620
MW 5.9
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...