Myosin (MYL4) (NM_001002841) Human 3' UTR Clone

CAT#: SC202421

3' UTR clone of myosin light chain 4 alkali; atrial embryonic (MYL4) transcript variant 1 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name Myosin (MYL4) (NM_001002841) Human 3' UTR Clone
Vector pMirTarget
Synonyms ALC1; AMLC; GT1; PRO1957
ACCN NM_001002841
Insert Size 209 bp
Sequence Data
>SC202421 3' UTR clone of NM_001002841
The sequence shown below is from the reference sequence of NM_001002841. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

GTCAAGCACATCATGTCAGGGTGAAGCAGAGTCTTCCAGGTGCCTGGCCCTTGGCTTTAGCCATACCAGG
GTGAGTTAAAGAGAGGCCCCGGCTGGGTGAGCTGAGATGGAGTCCTCGACTTATCACCACACCACTGCCC
CAAGGACCTTACAGGCCCTCCCTGTTAATAAACAGCTCTAACACGGCCAGGCTGGGCTCTGGGATTCTG

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001002841.1
Synonyms ALC1; AMLC; GT1; PRO1957
Summary Myosin is a hexameric ATPase cellular motor protein. It is composed of two myosin heavy chains, two nonphosphorylatable myosin alkali light chains, and two phosphorylatable myosin regulatory light chains. This gene encodes a myosin alkali light chain that is found in embryonic muscle and adult atria. Two alternatively spliced transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
Locus ID 4635
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...